Portal de Eventos da Universidade Federal do Vale do São Francisco (UNIVASF), SCIENTEX-2019

Tamanho da fonte: 
Desenvolvimento de um teste molecular para diagnóstico da mielopatia degenerativa canina.
Letícia Stheffany de Barros Cunha, Flávia Caroline Moreira Bezerra, Joel Fonseca Nogueira, Cássia Regina de Oliveira santos, Durval Baraúna Junior, João José Simoni gouveia

Última alteração: 2019-11-14

Resumo


A mielopatia degenerativa canina é uma doença neurodegenerativa de caráter recessivo associado ao éxon 2 do gene superóxido dismutase 1 (SOD1).  As lesões ocorrem de maneira descontinua, assimétrica e bilateral, sendo uma doença homologa à esclerose lateral amiotrófica em humanos. Os testes genéticos para doenças especificas, constituem uma importante ferramenta para auxiliar as estratégias de acasalamento, sendo uma maneira de diminuir o alelo da população. O método de diagnóstico da doença deve ser rápido, confiável, de baixo custo, e apresentar o diagnostico exato, como o método de ARMS-PCR, que possui a vantagem de combinar os passos de amplificação e diagnostico, além de não precisar de equipamentos sofisticados. O objetivo do trabalho foi desenvolver e validar um teste baseado em ARMS-PCR para genotipar a mutação c. 118G>A no éxon 2 do gene SOD1 em cães. Foram utilizadas amostras de swab oral de 97 cães para extração de DNA, sendo 22 animais heterozigotos, 2 homozigotos para o alelo doente e 73 homozigotos para o alelo selvagem, pertencentes a diferentes raças. A sequência utilizada para desenhar os primers foi retirada do banco de dados Ensembl, os conjuntos de primers foram desenhados no software Primer1, e analisados no software OligoAnalizer 3.1 para selecionar o melhor conjunto. O primeiro conjunto de primers escolhido foi: Fowardoutter: TCACATCTCCTTTGTGTTGGGTCCC; reverse outter: TGTGGATCATTTCCCTAAGGCTGACC; Fowardinner: TGGTATCAGGAACCATTACAGGGCTGAATA; reverse inner: GTGGAATCCATGCTCGCCGTC. As mudanças realizadas para testar o melhor resultado foram: Temperatura de anelamento dos primers, concentração de MgCl2, concentração de dNTP, e a concentração dentro do conjunto de primers, duração das etapas do ciclo de PCR, tempo de corrida do gel. Sem obtenção dos resultados esperados, visualização dos amplicons: 453pb, 269pb, 233pb, novos primers foram desenhados e analisados, e um novo conjunto foi escolhido. Os novos primers escolhidos foram: Fowardoutter: CCTAGGATTTGGGCACAGATC; reverse outter: AGTCAAAAACCGGCTTTGTG; Fowardinner: GGAACCATTACAGGGCTGAATA; reverse inner: AATCCATGCTCGCCGTC. Foram executados os testes, utilizando as mesmas modificações de parâmetros do conjunto de primers anteriores. Esse segundo conjunto também não obteve os resultados esperados, Visualização dos amplicons: 405pb, 201pb, 243pb. Os dois principais problemas com o método são: amplificação ineficiente das bandas desejadas, e a amplificação de bandas não especificas, que ocorrem com os primers selecionados.  Apesar de ser um método eficiente e barato, a ARMS-PCR possui algumas dificuldades, como a otimização. Os resultados podem ser influenciados por diversas variáveis, como a região em que o gene está inserido; a presença de reação espontânea nos primers; e o tempo necessário para testar as diversas condições. Então a técnica possui um conjunto de condições que devem estar certas para a reação funcionar, desde os primeiros passos com a análise dos primers, até as condições posteriores na PCR e eletroforese.


Palavras-chave


ARMS-PCR; Doenças genéticas; diagnostico molecular.